View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_15_82 (Length: 128)
Name: 108_15_82
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 108_15_82 |
| |
|
[»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 114; Significance: 3e-58; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 114; E-Value: 3e-58
Query Start/End: Original strand, 15 - 128
Target Start/End: Complemental strand, 19633322 - 19633209
Alignment:
Q |
15 |
aattaatattgttatatcatttgcgaataatacctttccataacaatagataaagtataatgatatttagtgatgctaggtatccttgaagaattgcgaa |
114 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19633322 |
aattaatattgttatatcatttgcgaataatacctttccataacaatagataaagtataatgatatttagtgatgctaggtatccttgaagaattgcgaa |
19633223 |
T |
|
Q |
115 |
taatttatctaata |
128 |
Q |
|
|
|||||||||||||| |
|
|
T |
19633222 |
taatttatctaata |
19633209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 574 times since January 2019
Visitors: 1071