View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_18_83 (Length: 403)
Name: 108_18_83
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_18_83 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 133; Significance: 5e-69; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 133; E-Value: 5e-69
Query Start/End: Original strand, 218 - 393
Target Start/End: Complemental strand, 43702992 - 43702814
Alignment:
| Q |
218 |
tcaattgggaacctgaaagagatttggcaatgagaacacaaaccagaaacaatgaaggggtggcgtttgtttttgatgagatgaa---ggagtgcatgat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
43702992 |
tcaattgggaacctgaaagagatttggcaatgagaacacaaaccagaaacaatggaggggtggcgtttgtttttgatgagatgaaggaggagtacatgat |
43702893 |
T |
 |
| Q |
315 |
gtgtctcattggaggaggaagagcagagggtgtgtgttnatttttcggtaaaatnntgctttttctaaacttnttactc |
393 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| ||||||||||||||| || ||||||||||| | |||||| |
|
|
| T |
43702892 |
gtgtcttattggaggaggaagagcagagggtgtgtgtttatttttcggtaaaataatgttttttctaaacattttactc |
43702814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 132 - 225
Target Start/End: Complemental strand, 3266999 - 3266906
Alignment:
| Q |
132 |
acaattgttcactatatcatgactctttttaatttattaatctttgctttatcaatagttacatgaaaagttcatatacacgcatatcaattgg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
3266999 |
acaattgttcactatatcatgactctttttaatttattaatctttgctttatcaatagttacatgaaaagttaatatacacgcatatcaattgg |
3266906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 69 - 110
Target Start/End: Complemental strand, 43701828 - 43701787
Alignment:
| Q |
69 |
cctcacacacaaaatcacaacagcggcatccatactcttatt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43701828 |
cctcacacacaaaatcacaacagcggcatccatacacttatt |
43701787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 97 - 139
Target Start/End: Complemental strand, 43701787 - 43701745
Alignment:
| Q |
97 |
tccatactcttattatttcagattactactactccacaattgt |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
43701787 |
tccatactcttattatttcagattactactcctcgacaattgt |
43701745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 269
Target Start/End: Original strand, 18947986 - 18948038
Alignment:
| Q |
218 |
tcaattgggaacctgaaagagatttggcaatg-agaacacaaaccagaaacaa |
269 |
Q |
| |
|
||||||| ||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
18947986 |
tcaattgtgaacctgaaagagatttggtaatgaaaaacacaaaccagaaacaa |
18948038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University