View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_7_76 (Length: 169)
Name: 108_7_76
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 108_7_76 |
 |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 61; Significance: 2e-26; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 1 - 114
Target Start/End: Original strand, 7173083 - 7173195
Alignment:
| Q |
1 |
gggatatgagtgaaaacaaacactcttgaagcaggggatgctagtatctccaaatcatcaaagag-aaatgaataaaacgnnnnnnntaaggtgatgcaa |
99 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| ||| | |||||||| ||||||||||||| |
|
|
| T |
7173083 |
gggatatgagtgaaaacaa-cactcttgaagtaggggatgctagtatctccaaatcatcaaagagaaaacggataaaacg-aataaataaggtgatgcaa |
7173180 |
T |
 |
| Q |
100 |
tcaacttatattaat |
114 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7173181 |
tcaacttatattaat |
7173195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 112 - 169
Target Start/End: Original strand, 7173030 - 7173087
Alignment:
| Q |
112 |
aattttatttataatcctttacgtataatccttcaaataaattttaggaattggggat |
169 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
7173030 |
aattttatttataatcctttacgtataatgcttcaaataaattttaggaattggggat |
7173087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 109 - 169
Target Start/End: Complemental strand, 14816504 - 14816443
Alignment:
| Q |
109 |
attaattttatttataatcctttacgtataatccttcaaataaattttagg-aattggggat |
169 |
Q |
| |
|
||||||||||||||||||| |||||||| | | |||||||||||||||||| |||||||||| |
|
|
| T |
14816504 |
attaattttatttataatcatttacgtaaacttcttcaaataaattttaggaaattggggat |
14816443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 7178395 - 7178460
Alignment:
| Q |
109 |
attaattttatttata----atcctttacgtataatccttcaaataaattttagg-aattggggat |
169 |
Q |
| |
|
|||||||||||||||| ||| |||||||| | |||||||||||||||||||| |||||||||| |
|
|
| T |
7178395 |
attaattttatttatactcaatcttttacgtaaactccttcaaataaattttaggaaattggggat |
7178460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 38; Significance: 0.0000000000009; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 109 - 169
Target Start/End: Original strand, 23207 - 23268
Alignment:
| Q |
109 |
attaattttatttataatcctttacgtataatccttcaaataaattttagg-aattggggat |
169 |
Q |
| |
|
||||||||||||||||||| |||||||| | | |||||||||||||||||| |||||||||| |
|
|
| T |
23207 |
attaattttatttataatcatttacgtaaacttcttcaaataaattttaggaaattggggat |
23268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University