View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 108_8_58 (Length: 425)
Name: 108_8_58
Description: Pascalseqs
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 108_8_58 |
![](./plan/images/spacer.gif) | ![108_8_58](./plan/images/spacer.gif) |
|
[»] chr1 (3 HSPs) |
![](./plan/images/spacer.gif) | ![chr1 (285-425)||(14934882-14935022)](./plan/images/spacer.gif) |
|
[»] scaffold0075 (1 HSPs) |
![](./plan/images/spacer.gif) | ![scaffold0075 (285-368)||(13095-13178)](./plan/images/spacer.gif) | ![](./plan/images/spacer.gif) |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 8e-65; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 285 - 425
Target Start/End: Original strand, 14934882 - 14935022
Alignment:
Q |
285 |
aattcaacacagatttcagcagtggagctgaatttttgtggnctcacggacagattcaagattcaacatatcaaatgttgaaaacagnatgcagtgttgc |
384 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
14934882 |
aattcaacacagatttcagcagtggagctgaatttttgtggtctcacggacagattcaagattcaacatatcaaatgttgaaaacagtatgcagtgttgc |
14934981 |
T |
![](./plan/images/spacer.gif) |
Q |
385 |
tgaaattagaagacanagtcggactgggaaacngagtnacg |
425 |
Q |
|
|
||||||||||||||| |||||||||||||||| |||| ||| |
|
|
T |
14934982 |
tgaaattagaagacagagtcggactgggaaactgagtaacg |
14935022 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 73 - 147
Target Start/End: Original strand, 14935025 - 14935100
Alignment:
Q |
73 |
tgtgataaagtaaatcggctattgtcaatggaggcatatttttaaaatttgatcattaa-ttttgtccatattttt |
147 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
14935025 |
tgtgataaagtaaatcggctattgtcaatggagacatatttttaaaatttgatcattaatttttgtccatattttt |
14935100 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 1 - 40
Target Start/End: Original strand, 14935018 - 14935057
Alignment:
Q |
1 |
taacgcatgtgataaagtaaatcagctattgtcaatggag |
40 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
14935018 |
taacgcatgtgataaagtaaatcggctattgtcaatggag |
14935057 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0075 (Bit Score: 41; Significance: 0.00000000000004; HSPs: 1)
Name: scaffold0075
Description:
Target: scaffold0075; HSP #1
Raw Score: 41; E-Value: 0.00000000000004
Query Start/End: Original strand, 285 - 368
Target Start/End: Original strand, 13095 - 13178
Alignment:
Q |
285 |
aattcaacacagatttcagcagtggagctgaatttttgtggnctcacggacagattcaagattcaacatatcaaatgttgaaaa |
368 |
Q |
|
|
||||| ||| ||||||||||||||||||||||||||||||| | ||||| || || || |||||||||||||||||||||| |
|
|
T |
13095 |
aattcgacaaagatttcagcagtggagctgaatttttgtggtcacacgggcaaatctccgaatcaacatatcaaatgttgaaaa |
13178 |
T |
![](./plan/images/spacer.gif) |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 17503 times since January 2019
Visitors: 1193