View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 11737-5_high_4 (Length: 216)
Name: 11737-5_high_4
Description: 11737-5
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 11737-5_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 204
Target Start/End: Complemental strand, 19173742 - 19173558
Alignment:
| Q |
18 |
catctcgtttcaacaaaacttgagtatttagtcttcctctcaagcaaggcagccgatatgaataatcaaatggtgggcctaggaattttgaaagttaatg |
117 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19173742 |
catctcgtttcaacaaaacttgagcatttagtcttcctctcaagcaaggcagccgatatgaataatcaaatggtgggcctaggaattttgaaagttaatg |
19173643 |
T |
|
| Q |
118 |
ttgaaactatcactcgtttgaaagtttcgcatggtggagataggaagtaagccccacaacacaaagtggcgaagaacaaatagaatt |
204 |
Q |
| |
|
||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19173642 |
ttgaaactatcactcgtttgaaagttttacacagtggagataggaagtaagccccacaacac--agtggcgaagaacaaatagaatt |
19173558 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 158 - 204
Target Start/End: Original strand, 25565003 - 25565049
Alignment:
| Q |
158 |
taggaagtaagccccacaacacaaagtggcgaagaacaaatagaatt |
204 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
25565003 |
taggaagtaagccccacaacccaaagcggcgaagaacaaatagaatt |
25565049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37818 times since January 2019
Visitors: 2923