View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 235Eco4 (Length: 80)
Name: 235Eco4
Description: NF0235-1
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 235Eco4 |
 | |
|
| [»] scaffold0015 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 65; Significance: 3e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 65; E-Value: 3e-29
Query Start/End: Original strand, 10 - 78
Target Start/End: Complemental strand, 60219 - 60151
Alignment:
| Q |
10 |
gaggcacaatctaaacgtggtatcctcactctcaagtacccaattgagcatggtattgttagtaattgg |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
60219 |
gaggcacaatctaaacgtggtatcctcactctcaagtacccaattgagcatggtattgttagcaattgg |
60151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 30; Significance: 0.00000002; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 74
Target Start/End: Original strand, 67153 - 67190
Alignment:
| Q |
37 |
actctcaagtacccaattgagcatggtattgttagtaa |
74 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
67153 |
actctaaagtacccaattgagcatggaattgttagtaa |
67190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.00000009; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.00000009
Query Start/End: Original strand, 46 - 78
Target Start/End: Complemental strand, 37051367 - 37051335
Alignment:
| Q |
46 |
tacccaattgagcatggtattgttagtaattgg |
78 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
37051367 |
tacccaattgagcatgggattgttagtaattgg |
37051335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 965 times since January 2019
Visitors: 2388