View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-11 (Length: 145)
Name: 454-NF4349-Insertion-11
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-11 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 3e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 3e-74
Query Start/End: Original strand, 1 - 145
Target Start/End: Complemental strand, 37164303 - 37164159
Alignment:
Q |
1 |
aatctagcatttgactctaaacctcatatttactataacaacttctaaaccattcttcaataatctacattcaaacaaatttctattttggacaccattc |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
37164303 |
aatctagcatttgactctaaacctcatatttactataacaacttctaaaccattcttcaataatctacattcaaacatatttctattttggacaccattc |
37164204 |
T |
 |
Q |
101 |
tgaattgcacactccggtagggtttgacggaggattaccaccgcc |
145 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37164203 |
tgaattgcacactccggtagggtttgacggaggattaccaccgcc |
37164159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University