View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-14 (Length: 116)
Name: 454-NF4349-Insertion-14
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 2e-28; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 2e-28
Query Start/End: Original strand, 4 - 95
Target Start/End: Original strand, 10507855 - 10507946
Alignment:
Q |
4 |
tgtagtgtttggggttcaaattccaactcatgtatcaaaacaaattgtccataaggacgtattaaaacaaattgtccaagtagacctctcaa |
95 |
Q |
|
|
||||| |||||||||||| | ||| |||||||||| ||||||||||||||| ||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
10507855 |
tgtagcgtttggggttcatactccgactcatgtattaaaacaaattgtccaaaaggatgtattaaaacaaattgtccaagtagacctctcaa |
10507946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2215 times since January 2019
Visitors: 846