View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-16 (Length: 48)
Name: 454-NF4349-Insertion-16
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-16 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.000000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.000000000003
Query Start/End: Original strand, 13 - 48
Target Start/End: Complemental strand, 4065791 - 4065756
Alignment:
Q |
13 |
catcatcaatcacaatgagcaagaattacacaaaag |
48 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |
|
|
T |
4065791 |
catcatcaatcacaatgagcaagaattacacaaaag |
4065756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University