View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-23 (Length: 128)
Name: 454-NF4349-Insertion-23
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4349-Insertion-23 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 109; Significance: 3e-55; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 12 - 124
Target Start/End: Original strand, 6188302 - 6188414
Alignment:
Q |
12 |
aattcatcatggtacaaggtcatttccatgccaaaacataaagactatatacttcttcatcaagtctcatttacattagcactcactttgtgacatatgc |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
6188302 |
aattcatcatggtacaaggtcatttccatgccaaaacataaagactatatacttcttcatcaagtctcatttacattatcactcactttgtgacatatgc |
6188401 |
T |
 |
Q |
112 |
aaaaatattgtgt |
124 |
Q |
|
|
||||||||||||| |
|
|
T |
6188402 |
aaaaatattgtgt |
6188414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University