View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4349-Insertion-25 (Length: 140)

Name: 454-NF4349-Insertion-25
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4349-Insertion-25
454-NF4349-Insertion-25
[»] chr2 (1 HSPs)
chr2 (1-140)||(12936039-12936178)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 12936178 - 12936039
Alignment:
1 gatgcatagtaaaaggaagtaatagtttgaaatatgaatgagaaagcaagatgtatctagttgatattgctcttgaatgccatcaaagacattcttacaa 100  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||    
12936178 gatgcatagtacaaggaagtaatagtttgaaatatgaatgagaaagcaagatgcatctagttgatattgctcttgaatgacatcaaagacattcttacaa 12936079  T
101 attgtatgattcgaaaactaagaacttgatggcaaacaga 140  Q
    ||||||||||||||||||||||||||||||||||||||||    
12936078 attgtatgattcgaaaactaagaacttgatggcaaacaga 12936039  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2203 times since January 2019
Visitors: 845