View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-5 (Length: 274)
Name: 454-NF4349-Insertion-5
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4349-Insertion-5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 7e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 3 - 197
Target Start/End: Original strand, 17881780 - 17881975
Alignment:
| Q |
3 |
gcttccattgaaatgtagggataactgatttgatgccctccatcaaacaaa--ctggaaaaaattaaagttaaacagcctcgcatcaaaatagaatgtga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||| ||| ||||||||||||||||| |||||| ||||| |
|
|
| T |
17881780 |
gcttccattgaaatgtagggataactgatttgatgccctcaatcaaacaaaaactggatgaaaaaaaaaataaacagcctcgcatcagaataga-tgtga |
17881878 |
T |
|
| Q |
101 |
agttgaaacatggaatttagtaataaaatggatatcaggaaatctgagaggggggagggaaggccccaaaggaagggagcggaacataagttgcggc |
197 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||||||||||||||||| ||||||||| || |||||||||||||||| | |||||||||||| |
|
|
| T |
17881879 |
agttgaaacatggaatttagttataaaactgatatcaggaaatctgagagggaggagggaagcccacaaaggaagggagcggcatataagttgcggc |
17881975 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 207 - 247
Target Start/End: Original strand, 17882011 - 17882051
Alignment:
| Q |
207 |
cgctggagcaaccataagaaagtgctctttctctatctcaa |
247 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17882011 |
cgctggaacaaccataagaaagtgctctttctctatctcaa |
17882051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 3e-20; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 89 - 151
Target Start/End: Complemental strand, 23460919 - 23460857
Alignment:
| Q |
89 |
aatagaatgtgaagttgaaacatggaatttagtaataaaatggatatcaggaaatctgagagg |
151 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
23460919 |
aatagaatgtgaagttgaaacatggagtttagtcataaaattgatatcaggaaatctgagagg |
23460857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 94 - 182
Target Start/End: Original strand, 28383195 - 28383283
Alignment:
| Q |
94 |
aatgtgaagttgaaacatggaatttagtaataaaatggatatcaggaaatctgagaggggggagggaaggccccaaaggaagggagcgg |
182 |
Q |
| |
|
|||||||||||| ||||||||||||||| |||||| ||||||||||||||||||||| ||| ||||| || ||| ||||| |||||| |
|
|
| T |
28383195 |
aatgtgaagttggaacatggaatttagtgataaaactaatatcaggaaatctgagagggaggaaggaagccctcaatggaagagagcgg |
28383283 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37719 times since January 2019
Visitors: 2913