View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4349-Insertion-8 (Length: 158)
Name: 454-NF4349-Insertion-8
Description: 454-NF4349
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4349-Insertion-8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 1 - 158
Target Start/End: Complemental strand, 28676042 - 28675885
Alignment:
| Q |
1 |
aacttcatgtttgtgaatgtgcttgtgtgctgaaataaaagggcaatatagccaacagcaagaagtgtgatgattgttgaatggatgatttcatggctta |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
28676042 |
aacttaatgtttgtgaatgtgcttgtgtgctgaaataaaagggcaatatagccaacagcaagaagggtgatgattgttgaatggatgattttatggctta |
28675943 |
T |
|
| Q |
101 |
gttatgatggttgttcaataggccattcaaattgttcaaccgatagggctgtaacttc |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
28675942 |
gttatgatggttgttcaatacgccattcaaattgttcaaccgatagtgctgtaacttc |
28675885 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38687 times since January 2019
Visitors: 3001