View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4352-Insertion-6 (Length: 117)
Name: 454-NF4352-Insertion-6
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4352-Insertion-6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 6 - 117
Target Start/End: Original strand, 55932755 - 55932867
Alignment:
| Q |
6 |
tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaa-acaaaataaaagttgatgtatcaatgagaaaaacaacttcaaaccatgg |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
55932755 |
tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaaaacaaaatcaaagttgatgtatcaatgagaaaaacagcttcaaaccatgg |
55932854 |
T |
 |
| Q |
105 |
caccacttttcta |
117 |
Q |
| |
|
||||||||||||| |
|
|
| T |
55932855 |
caccacttttcta |
55932867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University