View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: 454-NF4352-Insertion-6 (Length: 117)

Name: 454-NF4352-Insertion-6
Description: 454-NF4352
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] 454-NF4352-Insertion-6
454-NF4352-Insertion-6
[»] chr4 (1 HSPs)
chr4 (6-117)||(55932755-55932867)


Alignment Details
Target: chr4 (Bit Score: 97; Significance: 4e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 97; E-Value: 4e-48
Query Start/End: Original strand, 6 - 117
Target Start/End: Original strand, 55932755 - 55932867
Alignment:
6 tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaa-acaaaataaaagttgatgtatcaatgagaaaaacaacttcaaaccatgg 104  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||| |||||||||||||    
55932755 tatgtatgaatatatatgtgcatgcatggaagttcctatggcaaagaaaaaacaaaatcaaagttgatgtatcaatgagaaaaacagcttcaaaccatgg 55932854  T
105 caccacttttcta 117  Q
    |||||||||||||    
55932855 caccacttttcta 55932867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University