View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4353-Insertion-12 (Length: 144)
Name: 454-NF4353-Insertion-12
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4353-Insertion-12 |
 |  |
|
[»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 6e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 6e-66
Query Start/End: Original strand, 6 - 144
Target Start/End: Original strand, 3039919 - 3040057
Alignment:
Q |
6 |
agctattcgaggatggtgatattcctagacagagaaaatttatgggtacagaagaatttatttttggatgaattgcataaggtaagaccaaataggccct |
105 |
Q |
|
|
||||||| ||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3039919 |
agctatttgaggatggtgataatcctagacagggaaaatttatgggtacagaagaatttatttttggatgaattgcataaggtaagaccaaataggccct |
3040018 |
T |
 |
Q |
106 |
tacagtttctatgtaaacccttatttcaaccttcacatg |
144 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3040019 |
tacagtttctatgtaaacccttatttcaaccttcacatg |
3040057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University