View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4353-Insertion-2 (Length: 205)
Name: 454-NF4353-Insertion-2
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4353-Insertion-2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 154; Significance: 7e-82; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 7 - 167
Target Start/End: Original strand, 3053861 - 3054022
Alignment:
| Q |
7 |
agacaaacttcatctcatctatgttgtagctcaatgaggtgatgtggcaaaa-aatctaggttttagttttagacctaaaagaagtgatatggcaaacca |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3053861 |
agacaaacttcatctcatctatgttgtagctcaatgaggtgatgtggcaaaaaaatctaggttttagttttagacctaaaagaagtgatatggcaaacca |
3053960 |
T |
|
| Q |
106 |
tttattaacatggcatataacgttacttttgtaaaatcatttagataaattaaccaagtaat |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3053961 |
tttattaacatggcatataacgttacttttgtaaaatcatttagataaattaaccaagtaat |
3054022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 30 - 181
Target Start/End: Original strand, 3039595 - 3039743
Alignment:
| Q |
30 |
ttgtagctcaatgaggtgatgtggcaaaaaatctaggttttagttttagacctaaaagaagtgatatggcaaaccatttattaacatggcatataacgtt |
129 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||| |||||||||||||||||||||||| || || |
|
|
| T |
3039595 |
ttgtggctcaatgaggtgatgtggcaaaaaatctaggttttagttttagacctaagagaagtgatgtgggaaaccatttattaacatggcatatgac-tt |
3039693 |
T |
|
| Q |
130 |
acttttgtaaaatcatttagataaattaaccaagtaattatggtcaaatgat |
181 |
Q |
| |
|
|||||| |||||||||| | |||||||||||||| ||||||||||||||| |
|
|
| T |
3039694 |
gcttttgaaaaatcattt--acaaattaaccaagtacttatggtcaaatgat |
3039743 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 152 - 205
Target Start/End: Original strand, 3054166 - 3054219
Alignment:
| Q |
152 |
aaattaaccaagtaattatggtcaaatgatttcgatgagactatacttatctca |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
3054166 |
aaattaaccaagtaattatggtcaaatgattttgatcagactatacttatctca |
3054219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2181 times since January 2019
Visitors: 844