View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4353-Insertion-4 (Length: 79)
Name: 454-NF4353-Insertion-4
Description: 454-NF4353
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4353-Insertion-4 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 79; Significance: 1e-37; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 79; E-Value: 1e-37
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 1218442 - 1218520
Alignment:
| Q |
1 |
gttagaatttagaatagcaaccatgattcaaaggtaaggttacatatatgaaaaatgcaaacaaagaacacgcgatatt |
79 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1218442 |
gttagaatttagaatagcaaccatgattcaaaggtaaggttacatatatgaaaaatgcaaacaaagaacacgcgatatt |
1218520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University