View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4354-Insertion-2 (Length: 70)
Name: 454-NF4354-Insertion-2
Description: 454-NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] 454-NF4354-Insertion-2 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 70; Significance: 3e-32; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 1 - 70
Target Start/End: Original strand, 3239127 - 3239196
Alignment:
Q |
1 |
gaaggagctataaaaacattgaaatgaggaagatggttattccttcaaatccagaagccattgattttgg |
70 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3239127 |
gaaggagctataaaaacattgaaatgaggaagatggttattccttcaaatccagaagccattgattttgg |
3239196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University