View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: 454-NF4354-Insertion-5 (Length: 65)
Name: 454-NF4354-Insertion-5
Description: 454-NF4354
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] 454-NF4354-Insertion-5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 61; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 61; E-Value: 6e-27
Query Start/End: Original strand, 5 - 65
Target Start/End: Original strand, 48584499 - 48584559
Alignment:
| Q |
5 |
gttaacattattaattaatgatgcatgtttcttaatgtcttccataaactcatcaagattc |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48584499 |
gttaacattattaattaatgatgcatgtttcttaatgtcttccataaactcatcaagattc |
48584559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.00000007; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.00000007
Query Start/End: Original strand, 33 - 65
Target Start/End: Complemental strand, 19666506 - 19666474
Alignment:
| Q |
33 |
ttcttaatgtcttccataaactcatcaagattc |
65 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
19666506 |
ttcttaatgtcttccataaattcatcaagattc |
19666474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University