View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: D682-LTR4-TNT-insertion-1 (Length: 205)
Name: D682-LTR4-TNT-insertion-1
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] D682-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 6 - 197
Target Start/End: Original strand, 49475420 - 49475611
Alignment:
| Q |
6 |
caaaacataccggaacagcccaaaaaggaatggtgttatctttcagtgggtatctaaggtccgtcatcatatcctctccaacaaaacggtgaaatggctc |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
49475420 |
caaaacataccggaacagcccaaaaaggaatagtgttatctttcagtgggtatctaaggtccgtcatcatatcttctccaacaaaacggtgaaatggctc |
49475519 |
T |
|
| Q |
106 |
tattatattcaagacagcatcaattaccacaagaagcaaaagaatcaaccagtcatgcatatgtatccttgcgactctagctccatgtgatc |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
49475520 |
tattatattcaagacagcatcaattaccacaagaagcaaaagaatcaaccagtcatgcatatgtatccttgcaactctagctccatgtgatc |
49475611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2236 times since January 2019
Visitors: 847