View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: D682-LTR4-TNT-insertion-10 (Length: 205)
Name: D682-LTR4-TNT-insertion-10
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] D682-LTR4-TNT-insertion-10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 8 - 197
Target Start/End: Original strand, 50580381 - 50580569
Alignment:
| Q |
8 |
gtattcatgcatgacccaattactnntctctcctcgaggagctntgccttngtaaaagaccaatgtcttnttcattccaaccaactccgatgtaacactg |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
50580381 |
gtattcatgcatgacccaattacttttctctcctcgaggagctctgcctttgtaaaagaccaatgtcttcttcattccaaccaactccgatgtaacactg |
50580480 |
T |
 |
| Q |
108 |
tcgaagatttctcngtcnttccctgtggtcntccagtatccggngtntgttgctcgattcgttctcacagccggntggatatttacgatc |
197 |
Q |
| |
|
||||||||||||| ||| |||||||||||| |||||||||||| || |||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
50580481 |
tcgaagatttctctgtctttccctgtggtcttccagtatccggtgtttgttgctcgattcgttctcaca-ccggttggatatttacgatc |
50580569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 8 - 197
Target Start/End: Complemental strand, 1059413 - 1059225
Alignment:
| Q |
8 |
gtattcatgcatgacccaattactnntctctcctcgaggagctntgccttngtaaaagaccaatgtcttnttcattccaaccaactccgatgtaacactg |
107 |
Q |
| |
|
|||||||||||| ||||| || | ||||||||| |||||| |||| |||||| ||||| ||||| ||||| ||||| || || |||||||||||| |
|
|
| T |
1059413 |
gtattcatgcataacccagttggttttctctcctctaggagcccgacctttgtaaaaaaccaaagtcttcttcataccaactaattctgatgtaacactg |
1059314 |
T |
 |
| Q |
108 |
tcgaagatttctcngtcnttccctgtggtcntccagtatccggngtntgttgctcgattcgttctcacagccggntggatatttacgatc |
197 |
Q |
| |
|
| ||| || || ||| ||||||||||| |||| ||||| | || |||||||| ||| ||||||||| || | ||||||||||||||| |
|
|
| T |
1059313 |
ttgaaaatctccttgtctttccctgtggttttccaatatccagtgtttgttgctctattagttctcaca-cctgttggatatttacgatc |
1059225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University