View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: D682-LTR4-TNT-insertion-9 (Length: 249)
Name: D682-LTR4-TNT-insertion-9
Description: D682-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] D682-LTR4-TNT-insertion-9 |
 |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
| [»] scaffold0148 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0280 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 11 - 241
Target Start/End: Original strand, 1723 - 1953
Alignment:
| Q |
11 |
attgtcggtgattggacataatgttacggcttgccattggatacacccaaattaagttgttgaaaaattgaagatacaagattgttgttgcttactttcg |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1723 |
attgtcggtgattggacataatgttacggcttgccattggatacacccaaattaagttgttgaaaaattgaagatacaagattgttgttgctttctttcg |
1822 |
T |
 |
| Q |
111 |
atacaacataaaagctcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatggcaatcaacaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
1823 |
atacaacataaaagctcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatagaaatcaacaa |
1922 |
T |
 |
| Q |
211 |
agttatcacaaacgggttcggaaggtggatc |
241 |
Q |
| |
|
|||||||||||||| |||||||||||||||| |
|
|
| T |
1923 |
agttatcacaaacgagttcggaaggtggatc |
1953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0148 (Bit Score: 65; Significance: 1e-28; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 126 - 238
Target Start/End: Original strand, 26992 - 27104
Alignment:
| Q |
126 |
tcgccactccatttatactttgcattgcaaagacacttgtttcctttactacaggtagaatgtttccaaccatggcaatcaacaaagttatcacaaacgg |
225 |
Q |
| |
|
|||||| |||| ||||| |||||||||||||||||| | |||||||||||||| |||||||| ||||| ||||||||||||||| |||||| ||| | || |
|
|
| T |
26992 |
tcgccattccagttatagtttgcattgcaaagacacctctttcctttactacaagtagaatggttccagccatggcaatcaacagagttattacagatgg |
27091 |
T |
 |
| Q |
226 |
gttcggaaggtgg |
238 |
Q |
| |
|
||||||||||||| |
|
|
| T |
27092 |
gttcggaaggtgg |
27104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University