View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-14 (Length: 130)
Name: F9049J-LTR4-TNT-insertion-14
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9049J-LTR4-TNT-insertion-14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 7 - 120
Target Start/End: Original strand, 26649796 - 26649909
Alignment:
Q |
7 |
aattagtagctatatatttggcctgtggagagagagatctttgaactacaaaggttttcaagaatatcttttaaatttgtacacccnnnnnnnnaacaag |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
T |
26649796 |
aattagtagctatatatttggcctgtggagagagagatctttgaactacaaaggttttcaagaatatcttttaaatttgtacacccttttttttaacaag |
26649895 |
T |
 |
Q |
107 |
ccaaaatggaatta |
120 |
Q |
|
|
|||||||||||||| |
|
|
T |
26649896 |
ccaaaatggaatta |
26649909 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University
This website was viewed 3544 times since January 2019
Visitors: 8689