View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-3 (Length: 227)

Name: F9049J-LTR4-TNT-insertion-3
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-3
F9049J-LTR4-TNT-insertion-3
[»] chr4 (1 HSPs)
chr4 (7-218)||(55970985-55971196)


Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 218
Target Start/End: Original strand, 55970985 - 55971196
Alignment:
7 atgtctatggtctcatgcctaaaagatcattgaagcccttattaccacctcctgaagccttgctttccattggtcactatcattcaacatgtccagatgc 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55970985 atgtctatggtctcatgcctaaaagatcattgaagcccttattaccacctcctgaagccttgctttccattggtcactatcattcaacatgtccagatgc 55971084  T
107 tgaaggcattatctcacaaaaagtttttgcttgggttaagaaggaccccaccttggcaccatccatcatccgcttgcattttcatgactgtgccgttaga 206  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55971085 tgaaggcattatctcacaaaaagtttttgcttgggttaagaaggaccccaccttggcaccatccatcatccgcttgcattttcatgactgtgccgttaga 55971184  T
207 gtaatttaatta 218  Q
    ||||||||||||    
55971185 gtaatttaatta 55971196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2254 times since January 2019
Visitors: 847