View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-3 (Length: 227)
Name: F9049J-LTR4-TNT-insertion-3
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9049J-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 218
Target Start/End: Original strand, 55970985 - 55971196
Alignment:
| Q |
7 |
atgtctatggtctcatgcctaaaagatcattgaagcccttattaccacctcctgaagccttgctttccattggtcactatcattcaacatgtccagatgc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55970985 |
atgtctatggtctcatgcctaaaagatcattgaagcccttattaccacctcctgaagccttgctttccattggtcactatcattcaacatgtccagatgc |
55971084 |
T |
|
| Q |
107 |
tgaaggcattatctcacaaaaagtttttgcttgggttaagaaggaccccaccttggcaccatccatcatccgcttgcattttcatgactgtgccgttaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55971085 |
tgaaggcattatctcacaaaaagtttttgcttgggttaagaaggaccccaccttggcaccatccatcatccgcttgcattttcatgactgtgccgttaga |
55971184 |
T |
|
| Q |
207 |
gtaatttaatta |
218 |
Q |
| |
|
|||||||||||| |
|
|
| T |
55971185 |
gtaatttaatta |
55971196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2254 times since January 2019
Visitors: 847