View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-4 (Length: 63)
Name: F9049J-LTR4-TNT-insertion-4
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9049J-LTR4-TNT-insertion-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 48; Significance: 3e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 40651037 - 40651084
Alignment:
| Q |
8 |
ataatctcttcaatgctatgcctatgaagaatcctcttgtttggaatt |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40651037 |
ataatctcttcaatgctatgcctatgaagaatcctcttgtttggaatt |
40651084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 31911726 - 31911769
Alignment:
| Q |
12 |
tctcttcaatgctatgcctatgaagaatcctcttgtttggaatt |
55 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31911726 |
tctcttcaatgccatgcctatgaagaatcctcttgtttggaatt |
31911769 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2247 times since January 2019
Visitors: 847