View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9049J-LTR4-TNT-insertion-4 (Length: 63)

Name: F9049J-LTR4-TNT-insertion-4
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9049J-LTR4-TNT-insertion-4
F9049J-LTR4-TNT-insertion-4
[»] chr3 (1 HSPs)
chr3 (8-55)||(40651037-40651084)
[»] chr8 (1 HSPs)
chr8 (12-55)||(31911726-31911769)


Alignment Details
Target: chr3 (Bit Score: 48; Significance: 3e-19; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 3e-19
Query Start/End: Original strand, 8 - 55
Target Start/End: Original strand, 40651037 - 40651084
Alignment:
8 ataatctcttcaatgctatgcctatgaagaatcctcttgtttggaatt 55  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
40651037 ataatctcttcaatgctatgcctatgaagaatcctcttgtttggaatt 40651084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 12 - 55
Target Start/End: Original strand, 31911726 - 31911769
Alignment:
12 tctcttcaatgctatgcctatgaagaatcctcttgtttggaatt 55  Q
    |||||||||||| |||||||||||||||||||||||||||||||    
31911726 tctcttcaatgccatgcctatgaagaatcctcttgtttggaatt 31911769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2247 times since January 2019
Visitors: 847