View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-5 (Length: 320)
Name: F9049J-LTR4-TNT-insertion-5
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9049J-LTR4-TNT-insertion-5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 136; Significance: 6e-71; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 175 - 310
Target Start/End: Original strand, 6888074 - 6888209
Alignment:
| Q |
175 |
gatcgaacgatcatcgatgtattgactgcgtgaaagacggatcatgcagaatgatagtaatccgtaatttaaaacaattttttactcacggtactttctc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6888074 |
gatcgaacgatcatcgatgtattgactgcgtgaaagacggatcatgcagaatgatagtaatccgtaatttaaaacaattttttactcacggtactttctc |
6888173 |
T |
|
| Q |
275 |
tctctttcactatttgaaattctgaaacagtgatta |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6888174 |
tctctttcactatttgaaattctgaaacagtgatta |
6888209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 8 - 118
Target Start/End: Original strand, 6887907 - 6888017
Alignment:
| Q |
8 |
gaaatgagctatctcactttattccatgcaatcaacaatttctcgcattcacgcagtttagacatcgatatcggttcatcaagaacaaatgtcgtcgaga |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6887907 |
gaaatgagctatctcactttattccatgcaatcaacaatttctcgcattcacgcagtttagacatcgatatcggttcatcaagaacaaatgtcgtcgaga |
6888006 |
T |
|
| Q |
108 |
ttcatgttctc |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
6888007 |
ttcatgttctc |
6888017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2275 times since January 2019
Visitors: 848