View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9049J-LTR4-TNT-insertion-8 (Length: 223)
Name: F9049J-LTR4-TNT-insertion-8
Description: F9049J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9049J-LTR4-TNT-insertion-8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 213
Target Start/End: Original strand, 1809237 - 1809442
Alignment:
Q |
8 |
acaacgactcaataggaaacttggcagtgacattttcattgctgcaaatacagcacaaatgcacaaagactttgttactaatccaacagcttatggtact |
107 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1809237 |
acaacgactcaataggaaacttggcagtgacattttcattgctgcaaatacagcacaaatgcacaaagactttgttactaatccaacagcttatggtact |
1809336 |
T |
 |
Q |
108 |
aatactttatattagactctattgccaactttcattttcaacaactagtttctcattattgaagtaacaaatagattagtaacatttaatttatgttgtt |
207 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1809337 |
aatactttatattagactctattgccaactttcattttcaacaactagtttctcattattgaagtaacaaatagattagtaacatttaatttatgttgtt |
1809436 |
T |
 |
Q |
208 |
gaatta |
213 |
Q |
|
|
|||||| |
|
|
T |
1809437 |
gaatta |
1809442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University