View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9091J-LTR4-TNT-insertion-1 (Length: 151)
Name: F9091J-LTR4-TNT-insertion-1
Description: F9091J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9091J-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 4e-70; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 4e-70
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 2196378 - 2196245
Alignment:
| Q |
8 |
agtagatagtctcaaaaagtcaaactaattcacctgaggggaatccatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2196378 |
agtagatagtctcaaaaagtcaaactaattcacctgaggggaatccatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcacc |
2196279 |
T |
|
| Q |
108 |
agcctgaatccaagcagattcatcggcaagatta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
2196278 |
agcctgaatccaagcagattcatcggcaagatta |
2196245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 46 - 141
Target Start/End: Complemental strand, 2175749 - 2175654
Alignment:
| Q |
46 |
gggaatccatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcaccagcctgaatccaagcagattcatcggcaagatta |
141 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2175749 |
gggaatgcatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcacctgcctgaatccaagcagattcatcggcaagatta |
2175654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 80; E-Value: 7e-38
Query Start/End: Original strand, 46 - 141
Target Start/End: Complemental strand, 2152078 - 2151983
Alignment:
| Q |
46 |
gggaatccatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcaccagcctgaatccaagcagattcatcggcaagatta |
141 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2152078 |
gggaatgcatgaactttacttgctttggagattttatagtatagttcacctaacgttgcacctgcctgaatccaagcagattcatcggcaagatta |
2151983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 110; Significance: 9e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 9e-56
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 35538641 - 35538509
Alignment:
| Q |
8 |
agtagatagtctcaaaaagtcaaactaattcacctgaggggaatccatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcacc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || |||||||||||||||||| ||| || |||||||||||||||||||||||||||||||||||| |
|
|
| T |
35538641 |
agtagatagtctcaaaaagtcaaactaattcacc-gaagggaatccatgaactttatttgtttcggagattttatagtaaagttcacctaatgttgcacc |
35538543 |
T |
|
| Q |
108 |
agcctgaatccaagcagattcatcggcaagatta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35538542 |
agcctgaatccaagcagattcatcggcaagatta |
35538509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 110; E-Value: 9e-56
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 35557075 - 35556942
Alignment:
| Q |
8 |
agtagatagtctcaaaaagtcaaactaattcacctgaggggaatccatgaactttacttgctttggagattttatagtaaagttcacctaatgttgcacc |
107 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||| || ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35557075 |
agtagatagtctcagaaagtcaaactaattcacctgaagggaatccatgaactttatttgtttcggagattttatagtaaagttcacttaatgttgcacc |
35556976 |
T |
|
| Q |
108 |
agcctgaatccaagcagattcatcggcaagatta |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
35556975 |
agcctgaatccaagcagattcatcggcaagatta |
35556942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37531 times since January 2019
Visitors: 2881