View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9096J-LTR4-TNT-insertion-1 (Length: 238)
Name: F9096J-LTR4-TNT-insertion-1
Description: F9096J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9096J-LTR4-TNT-insertion-1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 229
Target Start/End: Original strand, 7999053 - 7999272
Alignment:
Q |
10 |
aaaagtacatataaataacagcaaaagtcagggaacagaaaagaatacgnnnnnnntcaagaaaaacctgcaacaagacggaattgctgcggctgttgaa |
109 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7999053 |
aaaagtacatataaataacagcaaaagtcagggaacagaaaagaatacgaaaaaaatcaagaaaaacctgcaacaagacggaattgctgcggctgttgaa |
7999152 |
T |
 |
Q |
110 |
taggattattagcttttaatttcaaaattatcgtttaaaatgaaaattgaagggcattctgggtgtttcctagataaaaacatattgctttgtagtttca |
209 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7999153 |
taggattattagcttttaatttcaaaattatcgtttaaaatgaaaattgaagggcattctgggtgtttcctagataaaaacatattgctttgtagtttca |
7999252 |
T |
 |
Q |
210 |
gatgcacataggggcaattg |
229 |
Q |
|
|
|||||||||||||||||||| |
|
|
T |
7999253 |
gatgcacataggggcaattg |
7999272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University