View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9100J-LTR4-TNT-insertion-2 (Length: 147)
Name: F9100J-LTR4-TNT-insertion-2
Description: F9100J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9100J-LTR4-TNT-insertion-2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 130; Significance: 1e-67; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 9 - 138
Target Start/End: Original strand, 26455119 - 26455248
Alignment:
Q |
9 |
ggctttgagaaatcacactgatttgaaagttggaacgtattggggagagaaaggtgttgacaactgggatggagctatatggaaagaacaaatggagaaa |
108 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
26455119 |
ggctttgagaaatcacactgatttgaaagttggaacgtattggggagagaaaggtgttgacaactgggatggagctatatggaaagaacaaatggagaaa |
26455218 |
T |
 |
Q |
109 |
catgaggtgagagtctttgcatttcaattg |
138 |
Q |
|
|
|||||||||||||||||||||||||||||| |
|
|
T |
26455219 |
catgaggtgagagtctttgcatttcaattg |
26455248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 12 - 136
Target Start/End: Original strand, 26446939 - 26447064
Alignment:
Q |
12 |
tttgagaaatcacactgatttgaaagttggaacgtattggggagagaaaggtgtt-gacaactgggatggagctatatggaaagaacaaatggagaaaca |
110 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| | | |||| ||| |||||||||||||||||||||| || |||||||||||| |
|
|
T |
26446939 |
tttgagaaatcacactgatttgaaagttggaacgtattggggagacatggttgttagacttctgggatggagctatatggaaaaaaaaaatggagaaacg |
26447038 |
T |
 |
Q |
111 |
tgaggtgagagtctttgcatttcaat |
136 |
Q |
|
|
|||||||||||||||||||||||||| |
|
|
T |
26447039 |
tgaggtgagagtctttgcatttcaat |
26447064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 79; E-Value: 3e-37
Query Start/End: Original strand, 9 - 136
Target Start/End: Complemental strand, 26447618 - 26447489
Alignment:
Q |
9 |
ggctttgagaaatcacactgatttgaaagttggaacgtattggggagagaaaggtgttgacaactgggatggagctatatggaaagaacaaatggagaaa |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||| ||| | ||||||||| || |||||||||||||||||||||| ||||||||||| |
|
|
T |
26447618 |
ggctttgagaaatcacactgatttgaaagttggaaggtattggagagtcatgggtgttgacttctaggatggagctatatggaaagaagaaatggagaaa |
26447519 |
T |
 |
Q |
109 |
c--atgaggtgagagtctttgcatttcaat |
136 |
Q |
|
|
| ||||||||||||||||||||||||||| |
|
|
T |
26447518 |
catatgaggtgagagtctttgcatttcaat |
26447489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 100; Significance: 8e-50; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 8e-50
Query Start/End: Original strand, 9 - 136
Target Start/End: Original strand, 29674014 - 29674141
Alignment:
Q |
9 |
ggctttgagaaatcacactgatttgaaagttggaacgtattggggagagaaaggtgttgacaactgggatggagctatatggaaagaacaaatggagaaa |
108 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||| | ||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
29674014 |
ggctttgagaaatcacactgatttgaaagttggaatgtattggggagacatgggtgttgacttctgggatggagctatatggaaagaacaaatggagaaa |
29674113 |
T |
 |
Q |
109 |
catgaggtgagagtctttgcatttcaat |
136 |
Q |
|
|
|||||||||||||||||| ||||||||| |
|
|
T |
29674114 |
catgaggtgagagtctttacatttcaat |
29674141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 6e-32; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 6e-32
Query Start/End: Original strand, 10 - 119
Target Start/End: Complemental strand, 11495368 - 11495259
Alignment:
Q |
10 |
gctttgagaaatcacactgatttgaaagttggaacgtattggggagagaaaggtgttgacaactgggatggagctatatggaaagaacaaatggagaaac |
109 |
Q |
|
|
||||||||||||||||||||||||||| |||||| |||||||||||| | ||||||||| |||||||||||| | ||||||||| | |||||||||||| |
|
|
T |
11495368 |
gctttgagaaatcacactgatttgaaaattggaatgtattggggagatatgggtgttgactactgggatggagatgtatggaaaggagaaatggagaaac |
11495269 |
T |
 |
Q |
110 |
atgaggtgag |
119 |
Q |
|
|
|||||||||| |
|
|
T |
11495268 |
atgaggtgag |
11495259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University