View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9101J-LTR4-TNT-insertion-10 (Length: 67)

Name: F9101J-LTR4-TNT-insertion-10
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9101J-LTR4-TNT-insertion-10
F9101J-LTR4-TNT-insertion-10
[»] chr3 (1 HSPs)
chr3 (8-57)||(19387716-19387765)


Alignment Details
Target: chr3 (Bit Score: 50; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 50; E-Value: 2e-20
Query Start/End: Original strand, 8 - 57
Target Start/End: Complemental strand, 19387765 - 19387716
Alignment:
8 acaattaccatataattaaagatgacatccgattgatattcagttgatta 57  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
19387765 acaattaccatataattaaagatgacatccgattgatattcagttgatta 19387716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2153 times since January 2019
Visitors: 843