View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9101J-LTR4-TNT-insertion-11 (Length: 287)
Name: F9101J-LTR4-TNT-insertion-11
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9101J-LTR4-TNT-insertion-11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 12343581 - 12343406
Alignment:
| Q |
8 |
caaaagactaaggaagttggacaagatatacagtcaaaagctcaggatgcaaagaaaacatcaacaacaacaacggcaacaacggcagcatgaggaaatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343581 |
caaaagactaaggaagttggacaagatatacagtcaaaagctcaggatgcaaagaaaacatcaacaacaacaacggcaacaacggcagcatgaggaaatg |
12343482 |
T |
|
| Q |
108 |
gacgagggtttggtttagtgtttttggggtttatgtgtgaaaataataaactatgtattgttatgtgggcttgcac |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12343481 |
gacgagggtttggtttagtgtttttggggtttatgtgtgaaaataataaactatgtattgttatgtgggcttgcac |
12343406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 38336 times since January 2019
Visitors: 2967