View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9101J-LTR4-TNT-insertion-3 (Length: 304)
Name: F9101J-LTR4-TNT-insertion-3
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9101J-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 129; Significance: 9e-67; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 129; E-Value: 9e-67
Query Start/End: Original strand, 126 - 254
Target Start/End: Complemental strand, 40704096 - 40703968
Alignment:
| Q |
126 |
tttcacttcaaaaagataaatattcaattccttaagataaatattcaaggtgttccacatgtaaacaatttttctttgcgagggttggtggttcttacac |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40704096 |
tttcacttcaaaaagataaatattcaattccttaagataaatattcaaggtgttccacatgtaaacaatttttctttgcgagggttggtggttcttacac |
40703997 |
T |
|
| Q |
226 |
ttccctctcctaataaaatttgctgattg |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40703996 |
ttccctctcctaataaaatttgctgattg |
40703968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 10 - 98
Target Start/End: Complemental strand, 40704212 - 40704124
Alignment:
| Q |
10 |
taatggacagagatttggaaggagaacttcataatcagtaagcaacaactttaagggggaggttacgagtgggacacacgtttataaac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40704212 |
taatggacagagatttggaaggagaacttcataatcagtaagcaacaactttaagggggaggttacgagtgggacacacgtttataaac |
40704124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37503 times since January 2019
Visitors: 2875