View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9101J-LTR4-TNT-insertion-5 (Length: 49)
Name: F9101J-LTR4-TNT-insertion-5
Description: F9101J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9101J-LTR4-TNT-insertion-5 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 33; Significance: 0.0000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.0000000002
Query Start/End: Original strand, 8 - 40
Target Start/End: Original strand, 6716689 - 6716721
Alignment:
| Q |
8 |
cctgaatcatggaaggattacaaacaacaattg |
40 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
6716689 |
cctgaatcatggaaggattacaaacaacaattg |
6716721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 37640 times since January 2019
Visitors: 2899