View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9119J-LTR4-TNT-insertion-2 (Length: 221)

Name: F9119J-LTR4-TNT-insertion-2
Description: F9119J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9119J-LTR4-TNT-insertion-2
F9119J-LTR4-TNT-insertion-2
[»] chr7 (1 HSPs)
chr7 (10-211)||(2652192-2652393)


Alignment Details
Target: chr7 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 10 - 211
Target Start/End: Original strand, 2652192 - 2652393
Alignment:
10 aatagatttatacgccaagaaaatgacaaagtggaccaggtaccttaaatgaaaaacatgggttcaatttctcaatgaatgtctctagaaagctgtaatt 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2652192 aatagatttatacgccaagaaaatgacaaagtggaccaggtaccttaaatgaaaaacatgggttcaatttctcaatgaatgtctctagaaagctgtaatt 2652291  T
110 ataatttgttgcaatgattgccatcaaaagatattagaacactcgtatgattactccttgcaagatagaatatagaaatcttagtcttggtgttcttgaa 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2652292 ataatttgttgcaatgattgccatcaaaagatattagaacactcgtatgattactccttgcaagatagaatatagaaatcttagtcttggtgttcttgaa 2652391  T
210 tt 211  Q
    ||    
2652392 tt 2652393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2361 times since January 2019
Visitors: 852