View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9134J-LTR4-TNT-insertion-2 (Length: 56)
Name: F9134J-LTR4-TNT-insertion-2
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9134J-LTR4-TNT-insertion-2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 37; Significance: 0.0000000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.0000000000009
Query Start/End: Original strand, 10 - 46
Target Start/End: Complemental strand, 21164331 - 21164295
Alignment:
| Q |
10 |
ctatattatgatgatagcaacagaaaagtttggaatt |
46 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21164331 |
ctatattatgatgatagcaacagaaaagtttggaatt |
21164295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 587 times since January 2019
Visitors: 893