View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9134J-LTR4-TNT-insertion-3 (Length: 171)
Name: F9134J-LTR4-TNT-insertion-3
Description: F9134J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9134J-LTR4-TNT-insertion-3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 50; Significance: 7e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 55 - 104
Target Start/End: Original strand, 46893657 - 46893706
Alignment:
Q |
55 |
gtgaatgatgtttcttagttaaagcacatgctcttcaagtgcagcaaaca |
104 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46893657 |
gtgaatgatgtttcttagttaaagcacatgctcttcaagtgcagcaaaca |
46893706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 8 - 44
Target Start/End: Complemental strand, 21164331 - 21164295
Alignment:
Q |
8 |
ctatattatgatgatagcaacagaaaagtttggaatt |
44 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |
|
|
T |
21164331 |
ctatattatgatgatagcaacagaaaagtttggaatt |
21164295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University