View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9140J-LTR4-TNT-insertion-4 (Length: 180)
Name: F9140J-LTR4-TNT-insertion-4
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9140J-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 7 - 171
Target Start/End: Complemental strand, 42585921 - 42585757
Alignment:
Q |
7 |
aaatttaaagttaaaataatatttacgagtacttttctcagaggaatatttatgagtatatacctaaaatggagaatttcacnnnnnnnnntggaaaatt |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
T |
42585921 |
aaatttaaagttaaaataatatttacgagtacttttctcagaggaatatttatgagtatatacctaaaatggagaatttcacaaaaaaaaatggaaaatt |
42585822 |
T |
 |
Q |
107 |
aaattattattttttgcttcggaaaattagttgtttgttttttaacaaaaataacctaacaattg |
171 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42585821 |
aaattattattttttgcttcggaaaattagttgtttgttttttaacaaaaataacctaacaattg |
42585757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University