View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9140J-LTR4-TNT-insertion-5 (Length: 85)
Name: F9140J-LTR4-TNT-insertion-5
Description: F9140J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9140J-LTR4-TNT-insertion-5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 28; Significance: 0.0000004; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 35
Target Start/End: Original strand, 39628803 - 39628830
Alignment:
| Q |
8 |
acttctaagtggacaaataatcgtcctt |
35 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39628803 |
acttctaagtggacaaataatcgtcctt |
39628830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 54 - 85
Target Start/End: Original strand, 39628848 - 39628879
Alignment:
| Q |
54 |
tacacaaataatcaatagttatatttttggca |
85 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
39628848 |
tacacaaataatcgatagttatatttttggca |
39628879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University