View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9160J-LTR4-TNT-insertion-1 (Length: 275)
Name: F9160J-LTR4-TNT-insertion-1
Description: F9160J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9160J-LTR4-TNT-insertion-1 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 9 - 265
Target Start/End: Complemental strand, 35128982 - 35128726
Alignment:
| Q |
9 |
ggtccatccaactttaattgacccctcgcaaatggacggtaaaattgaacttctcaaattattcgatttggatatcgagttatnnnnnnnnnnnnttaca |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35128982 |
ggtccatccaactttaattgacccctcgcaaatggacggtaaaattgaacttctcaaattattcgatttggatatcgagttataaaaaaaaaaaattaca |
35128883 |
T |
|
| Q |
109 |
tagagaagagaacaagaccaaaaactttgattataaaattatctactcgaatacctactctcannnnnnnnnnnncactaaaacacattatatgacaagt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
35128882 |
tagagaagagaacaagaccaaaaactttgattataaaattatctactcgaatacctactttcatttttcttttttcactaaaacacattatatgacaagt |
35128783 |
T |
|
| Q |
209 |
ttcttttcaattatttttgagttataattagttataatatgattaggacagaaatta |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35128782 |
ttcttttcaattatttttgagttataattagttataatatgattaggacagaaatta |
35128726 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3404 times since January 2019
Visitors: 854