View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9164J-LTR4-TNT-insertion-11 (Length: 128)
Name: F9164J-LTR4-TNT-insertion-11
Description: F9164J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9164J-LTR4-TNT-insertion-11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 8 - 118
Target Start/End: Complemental strand, 45544920 - 45544810
Alignment:
| Q |
8 |
caaggtgatgccagattgttcactcttgatctccgtttcaagagcaggagaaactggttcacacttgatcaacataagatacctaatacaaatcgcaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45544920 |
caaggtgatgccagattgttcactcttgatctccgtttcaagagcaggagaaactggttcacacttgatcaacataagatacctaatacaaatcgcaaaa |
45544821 |
T |
 |
| Q |
108 |
taatttaatta |
118 |
Q |
| |
|
||||||||||| |
|
|
| T |
45544820 |
taatttaatta |
45544810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University