View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9186J-LTR4-TNT-insertion-3 (Length: 195)
Name: F9186J-LTR4-TNT-insertion-3
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9186J-LTR4-TNT-insertion-3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 3e-68; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 3e-68
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 14761120 - 14761250
Alignment:
| Q |
8 |
tgtatgagattcaatttaatcaattttaaatttaaaaaggaggcaccacaagaagagggacgacggtgagagcggttgaaaggaagcagtatgctatgtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14761120 |
tgtatgagattcaatttaatcaattttaaatttaaaaaggaggcaccacaagaagagggacgacggtgagagcggttgaaaggaagcagtatgctatgtt |
14761219 |
T |
|
| Q |
108 |
tgtagaaaatgggaagcaacgatgtgtttcc |
138 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14761220 |
tgtagaaaatgggaagcaacgatgtgtttcc |
14761250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 13017065 - 13017195
Alignment:
| Q |
8 |
tgtatgagattcaatttaatcaattttaaatttaaaaaggaggcaccacaagaagagggacgacggtgag-agcggttgaaaggaagcagtatgctatgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||| | ||||| ||||| || ||| | ||||||||||||| | |||||||| |
|
|
| T |
13017065 |
tgtatgagattcaatttaatcaattttaaatttgcaaa-gaggcaccatgaaaagagagacgatggcgagcaatggttgaaaggaagtaacatgctatga |
13017163 |
T |
|
| Q |
107 |
ttgtagaaaatgggaagcaacgatgtgtttcc |
138 |
Q |
| |
|
||||||||| || |||| ||| |||||||||| |
|
|
| T |
13017164 |
ttgtagaaattgagaagaaacaatgtgtttcc |
13017195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 8 - 138
Target Start/End: Original strand, 13088443 - 13088573
Alignment:
| Q |
8 |
tgtatgagattcaatttaatcaattttaaatttaaaaaggaggcaccacaagaagagggacgacggtgag-agcggttgaaaggaagcagtatgctatgt |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||| | ||||| ||||| || ||| | ||||||||||||| | |||||||| |
|
|
| T |
13088443 |
tgtatgagattcaatttaatcaattttaaatttgcaaa-gaggcaccatgaaaagagagacgatggcgagcaatggttgaaaggaagtaacatgctatga |
13088541 |
T |
|
| Q |
107 |
ttgtagaaaatgggaagcaacgatgtgtttcc |
138 |
Q |
| |
|
||||||||| || |||| ||| |||||||||| |
|
|
| T |
13088542 |
ttgtagaaattgagaagaaacaatgtgtttcc |
13088573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2332 times since January 2019
Visitors: 850