View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9186J-LTR4-TNT-insertion-4 (Length: 332)
Name: F9186J-LTR4-TNT-insertion-4
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9186J-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 7 - 322
Target Start/End: Complemental strand, 11291046 - 11290731
Alignment:
Q |
7 |
actaaacacgtataaaagcctaataaaaattgtcaaattaagttacaaactgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttg |
106 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11291046 |
actaaacacgtataaaagcctaataaaaattgtcaaattaagttacaaactgtttttgcaaggtatttggctagcttgtatgaaggcttttgcttatttg |
11290947 |
T |
 |
Q |
107 |
ttgcggttgaaataaggatagaaataggaaggcagataatttaggttgatggccatactggtttatgcacaaatacagaaagcataggcataggtgattt |
206 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11290946 |
ttgcggttgaaataaggatagaaataggaaggcagataatttaggttgatggccatactggtttatgcacaaatacagaaagcataggcataggtgattt |
11290847 |
T |
 |
Q |
207 |
gagtttactaaaatagttgagccttaaggaagaggaggttgttgaagctgctcttgattcaagtcaagatttcatggtcattgctcatttnnnnnnntgc |
306 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
T |
11290846 |
gagtttactaaaatagttgagccttaaggaagaggaggttgttgaagctgctcttgattcaagtcaagatttcatggtcattgctcatttaaaaaaatgc |
11290747 |
T |
 |
Q |
307 |
tcaatttatctaatta |
322 |
Q |
|
|
|||||||||||||||| |
|
|
T |
11290746 |
tcaatttatctaatta |
11290731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University