View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9186J-LTR4-TNT-insertion-8 (Length: 153)
Name: F9186J-LTR4-TNT-insertion-8
Description: F9186J-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9186J-LTR4-TNT-insertion-8 |
 |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0246 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 144
Target Start/End: Complemental strand, 17373 - 17343
Alignment:
| Q |
114 |
actcatatatcgttttccgtcatatcaattg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17373 |
actcatatatcgttttccgtcatatcaattg |
17343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 144
Target Start/End: Complemental strand, 512367 - 512337
Alignment:
| Q |
114 |
actcatatatcgttttccgtcatatcaattg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
512367 |
actcatatatcgttttccgtcatatcaattg |
512337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 144
Target Start/End: Original strand, 18085570 - 18085600
Alignment:
| Q |
114 |
actcatatatcgttttccgtcatatcaattg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18085570 |
actcatatatcgttttccgtcatatcaattg |
18085600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 114 - 144
Target Start/End: Complemental strand, 40479434 - 40479404
Alignment:
| Q |
114 |
actcatatatcgttttccgtcatatcaattg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
40479434 |
actcatatatcgttttccgtcatatcaattg |
40479404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 115 - 144
Target Start/End: Original strand, 13485761 - 13485790
Alignment:
| Q |
115 |
ctcatatatcgttttccgtcatatcaattg |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13485761 |
ctcatatatcgttttccgtcatatcaattg |
13485790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University