View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9296-LTR4-TNT-insertion-9 (Length: 142)
Name: F9296-LTR4-TNT-insertion-9
Description: F9296-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9296-LTR4-TNT-insertion-9 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 124; Significance: 4e-64; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 124; E-Value: 4e-64
Query Start/End: Original strand, 10 - 133
Target Start/End: Original strand, 41096466 - 41096589
Alignment:
Q |
10 |
aactgccaaacttgatgttaacagatgataacatgtaagggagccttgaattggaagtagtgttccactatattatcatgatataactaactcagctcaa |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41096466 |
aactgccaaacttgatgttaacagatgataacatgtaagggagccttgaattggaagtagtgttccactatattatcatgatataactaactcagctcaa |
41096565 |
T |
 |
Q |
110 |
ctagtaagaaatctgagacaattg |
133 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
41096566 |
ctagtaagaaatctgagacaattg |
41096589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 627 times since January 2019
Visitors: 903