View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9301-LTR4-TNT-insertion-1 (Length: 103)

Name: F9301-LTR4-TNT-insertion-1
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9301-LTR4-TNT-insertion-1
F9301-LTR4-TNT-insertion-1
[»] chr4 (1 HSPs)
chr4 (8-93)||(22797034-22797119)
[»] chr2 (1 HSPs)
chr2 (8-60)||(40961956-40962008)


Alignment Details
Target: chr4 (Bit Score: 86; Significance: 1e-41; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 86; E-Value: 1e-41
Query Start/End: Original strand, 8 - 93
Target Start/End: Complemental strand, 22797119 - 22797034
Alignment:
8 gtttagggtgaaccacttttgaatgattcatccatagatcttctggtttctgatgatagccaaaaggttaagtaataagtggaatt 93  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22797119 gtttagggtgaaccacttttgaatgattcatccatagatcttctggtttctgatgatagccaaaaggttaagtaataagtggaatt 22797034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 8 - 60
Target Start/End: Complemental strand, 40962008 - 40961956
Alignment:
8 gtttagggtgaaccacttttgaatgattcatccatagatcttctggtttctga 60  Q
    |||| ||||||||||||||||||||||| | ||||| ||| || |||||||||    
40962008 gtttcgggtgaaccacttttgaatgatttagccataaatcatccggtttctga 40961956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2270 times since January 2019
Visitors: 848