View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9301-LTR4-TNT-insertion-4 (Length: 169)
Name: F9301-LTR4-TNT-insertion-4
Description: F9301-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] F9301-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 150; Significance: 1e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 150; E-Value: 1e-79
Query Start/End: Original strand, 10 - 159
Target Start/End: Original strand, 40283282 - 40283431
Alignment:
Q |
10 |
gctgctaaattcagttttgcagaattatcatttgctgcaaccaaaaacattggtgtatatttcttgaaactgctgattctattgtatggtgaagtgcagg |
109 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40283282 |
gctgctaaattcagttttgcagaattatcatttgctgcaaccaaaaacattggtgtatatttcttgaaactgctgattctattgtatggtgaagtgcagg |
40283381 |
T |
 |
Q |
110 |
actgaagcattaagagggaatcgttagctccttttttggcgaagtaatta |
159 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40283382 |
actgaagcattaagagggaatcgttagctccttttttggcgaagtaatta |
40283431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University