View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9303-LTR4-TNT-insertion-4 (Length: 106)
Name: F9303-LTR4-TNT-insertion-4
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9303-LTR4-TNT-insertion-4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 2e-43; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 2e-43
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 48235483 - 48235395
Alignment:
| Q |
8 |
ggacagacatgtatagtctaacctttgaaaagtggcaaggttggataagtagacgcgtttccttcaactttctcgcatgcgcatcatta |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48235483 |
ggacagacatgtatagtctaacctttgaaaagtggcaaggttggataagtagacgcgtttccttcaactttctcgcatgcgcatcatta |
48235395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 4e-26
Query Start/End: Original strand, 8 - 78
Target Start/End: Complemental strand, 48230443 - 48230372
Alignment:
| Q |
8 |
ggacagacatgtatagtctaacctttgaaaagtggcaaggttggataagt-agacgcgtttccttcaacttt |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
48230443 |
ggacagacatgtatagtctaacctttgaaaagtggcaaggttggataagtaagacacgtttccttcaacttt |
48230372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University