View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: F9303-LTR4-TNT-insertion-7 (Length: 59)

Name: F9303-LTR4-TNT-insertion-7
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] F9303-LTR4-TNT-insertion-7
F9303-LTR4-TNT-insertion-7
[»] chr4 (1 HSPs)
chr4 (10-49)||(39664614-39664653)


Alignment Details
Target: chr4 (Bit Score: 40; Significance: 0.00000000000002; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.00000000000002
Query Start/End: Original strand, 10 - 49
Target Start/End: Complemental strand, 39664653 - 39664614
Alignment:
10 ccatttaatgagtctttcaccagacatagcattgaaatta 49  Q
    ||||||||||||||||||||||||||||||||||||||||    
39664653 ccatttaatgagtctttcaccagacatagcattgaaatta 39664614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3430 times since January 2019
Visitors: 855