View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: F9303-LTR4-TNT-insertion-9 (Length: 112)
Name: F9303-LTR4-TNT-insertion-9
Description: F9303-LTR4
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] F9303-LTR4-TNT-insertion-9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 95; Significance: 6e-47; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 95; E-Value: 6e-47
Query Start/End: Original strand, 9 - 103
Target Start/End: Original strand, 7112161 - 7112255
Alignment:
| Q |
9 |
attatataagttagaagatattaaattttattattcaatatgtagtttacttttcattttcccccaacttttatgcatgaaaatcatatcaattg |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7112161 |
attatataagttagaagatattaaattttattattcaatatgtagtttacttttcattttcccccaacttttatgcatgaaaatcatatcaattg |
7112255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 36; Significance: 0.000000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.000000000009
Query Start/End: Original strand, 9 - 103
Target Start/End: Complemental strand, 9976778 - 9976679
Alignment:
| Q |
9 |
attatataagttagaagatattaaattttattattcaatatgtagtttacttttc-----attttcccccaacttttatgcatgaaaatcatatcaattg |
103 |
Q |
| |
|
||||| |||| ||||||||||||||||||| |||||||||||||||| ||||| |||||| |||| ||||||||||| ||||| ||||||||| |
|
|
| T |
9976778 |
attatttaaggtagaagatattaaattttaacattcaatatgtagttttattttcttgtgtttttccgccaaattttatgcatgtaaatcctatcaattg |
9976679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000005; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 103
Target Start/End: Complemental strand, 5695987 - 5695956
Alignment:
| Q |
72 |
ccaacttttatgcatgaaaatcatatcaattg |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
5695987 |
ccaacttttatgcacgaaaatcatatcaattg |
5695956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000005
Query Start/End: Original strand, 72 - 103
Target Start/End: Complemental strand, 5794470 - 5794439
Alignment:
| Q |
72 |
ccaacttttatgcatgaaaatcatatcaattg |
103 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| |
|
|
| T |
5794470 |
ccaacttttatgcacgaaaatcatatcaattg |
5794439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3427 times since January 2019
Visitors: 855